It should be noted that metal particles do not heat in a microwave electric field, since the electric field within the particles is screened to almost zero and so is unable to drive the heating process.
Five layers of 20-nm-sized TiO2 particles and two layers of 400-nm-sized TiO2 particles were screen printed on a TiCl4-treated FTO glass.
Then the dried gel was pulverized, since the sieve size of the particle gels were screened with the mesh of 80 (Tyler measurement, opening size: 0.177 mm).
Ten streptomycin resistant clones from each competition were restreaked to remove contaminating free-phage particles, and colonies were screened using primers targeting LES φ2 (LES1nesTTTGGTGATGATCGGCTTAGCTAGC, LES1nestR: TGTGGAAGCGATCAGTCT) and LES φ4 (4tot1F: GCTCATGAGTGGCTGACAAC, 4tot1R: TCTTGGGCAGAGAACCATTC) (James et al. 2012).
Seven parameters potentially influencing the extraction yield of samara oil and content of nervonic acid, including ultrasound irradiation time, ultrasound irradiation power, ultrasound temperature, liquid-solid ratio, soaking time, particle size and stirring rate, were screened through Plackett Burman design to determine the significant variables.
Specifically, the presence of influenza A virus particles in the feather swab samples were screened by one-step reverse transcription polymerase chain reaction (RT-PCR) specific for matrix (M) gene amplification.
Moreover, the particle suspension, including HPG system and foam system, were screened based on suspending time.
The formulations were screened on the basis of solubility, stability, emulsification efficiency, particle size and zeta potential.
Micrographs were screened out due to severe astigmatism, drift, inappropriate defocus, contamination, particle aggregation, and imperfect staining.
Both sets of chip samples were screened over a gyratory screen with a woven-wire mesh bottom screen with 3 mm openings to remove the fine particles.
