Your English writing platform
Discover LudwigExact(3)
The cDNA product was diluted, and PCR was performed with one primer targeting on the gene and the other primer partially same as the primer mentioned above (primer sequences, AAGCAGTGGTATCAACGCAGAGT).
However, we cannot exclude the risks that the music tests measure partially same traits thus containing a risk of multiple testing in causing overlapping results.
These results are consistent with the findings from a previous study in Finland [ 32] and suggest that insufficient sleep is strongly related to sleep duration but they definitely are not redundant because they share only partially same information.
Similar(57)
Something is partially the same in number if its "most principal part" remains numerically the same.
The experimental paradigm used was partially the same as in our previous study48 but now included a feedback/no feedback event.
In the less strict sense, being partially the same in number, the continuity of one part is sufficient.
These techniques above have partially the same process: they can transfer patterns onto the surface of a substrate.
If, however, being partially the same is a legitimate form of persistence, then we get to preserve both personal identity and the datum that we are mutable.
Remark 3.1 The methods used in this paper are the Khintchine-Kolmogorov type convergence theorem and the three series theorem for AANA random variables, which are partially the same as that in Jajte [1] and Jing and Liang [2].
In that study in which we used partially the same material as in this paper, we found highly consistent ccRCC tumor specific disturbances of thyroid hormone pathway: decrease of thyroid hormone receptor β1 (TRβ1) mRNA and protein, loss of type 1 iodothyonine deiodinase protein and lowered level of thyroid hormone, triiodothyronine (T3).
DAMPs can also be detected by TLRs and NLRs and their engagement induces NF-κB activation as well, suggesting that DAMPs and PAMPs use, at least partially, the same receptors and signaling pathways.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com