Sentence examples for parallel forward from inspiring English sources
Experiment 2 found parallel forward affective priming in the same paradigm.
It is true the symmetry has been damaged a little: it is no longer Cristiano Ronaldo, Bale and James Rodríguez versus Lionel Messi, Neymar and Luis Suárez, parallel players in parallel forward lines.
Specifically, users can develop and parallelize customized reconstruction algorithms by extending the Reduce and Update functions in API, which correspond to parallel forward and backprojection kernels, respectively.
PCRs for the mouse Notch4 gene were run in parallel (forward CTGCACCTAGCTGCCAGATTC and reverse CTGTCTGCTGGCCAATAGGAG).
The alternative bimodal forward signaling model encompasses a second, parallel forward signal that is still active in the GPSLAT-2 chimera.
While this will, over time, lead to some loss of binding affinity resulting in an essentially parallel forward shift of all peaks, the column will in return loose much of its adverse peculiarities and, thus, PGC columns, like red wine, become even better with age, which translates into many years of productive column life.
We argue doing so can eliminate the fine-grained naming in CCN, effectively utilize multi-path parallel forwarding, reduce the complexity of cache coordination and simplify the transport design.
In parallel, forward-looking healthcare organizations recognize that patient reported outcomes (PROs) are central to ensuring that quality and appropriate care is being delivered.
Like Shika dache, except feet parallel, facing forward.
Crested anhanguerian pterodactyloids with the following synapomorphies: well-defined parallel and forward curved striae and sulci on the anterior region of the premaxillary crest, and an anterior rounded expansion of the anterior margin of the premaxillary crest.
nov. can be diagnosed by at least two synapomorphies: the presence of strong, well-defined parallel and forward curved striae and sulci on the anterior region of the premaxillary crest – character state 38(1) –, and the presence of a rounded anterodorsal expansion of the anterior margin of the premaxillary crest – character 39(1).
