Sentence examples for pair sense from inspiring English sources

We constructed an shRNA against mouse Atg5 using the following oligo pair (sense and antisense strands are underlined while the loop is italicized): forward 5'-TGGATGAGATAACTGAAAGATTCAAGAGA TCTTTCAGTTATCTCATCCTTTTTTC-3'; reverse 5'-TCGAGAAAAAAGGATGA GATAACTGAAAGATCTCTTGAATCTTTCAGTTATCTCATCCA-3'.

As reference s16 ribosomal protein messenger RNA was included using the following primer pair: sense GATATTCGGGTCCGTGTGA; reverse TTGAGATGGACTGTCGGATG.

A 260-bp DNA fragment around rs2431697 was amplified with the primer pair: sense primer: 5′-AGAGGGGGTGAAAGAAGGAA-3′ and antisense primer: 5′-TTCTCAGTGCCAATGTGAGG-3′.

A second primer pair (sense oligonucleotide 5'-GACTGGAACTTGCAACTG-3' and antisense oligonucleotide 5'-GACGGTACAGGAAACAGAT-3') was used to amplify a 445 bp cDNA fragment from nucleotides +24 to +468 of mt2 short transcript (gb| BC049475|).

A one-step RT-PCR was carried out essentially as described [ 2] using the degenerate primer pair (sense primer 5′-GCTCTAGAATTGTTAATGARTACGGTCG-3′ and antisense primer, 5′-CACGCGTCIACCTATTTIGGRTTITG-3′) derived from conserved terminal domains of the CP gene.

A fourth primer pair (sense oligonucleotide 5'-AGGCTGCTTCAGGAGACC-3' and antisense oligonucleotide 5'-CCTAAAGAAGTGACGGTACC-3') was used to amplify a 769 bp cDNA fragment from nucleotides +550 to +1318 of ccnb1 transcript (gb| AB040435|).

In the sensing phase, a CR pair senses the availability of the selected data channel and once the selected data channel is idle, the CR sender starts sending data packets.

The pol β(E295K) mutation alters a critical residue in the sensor effector coupling pathway that constitutes the functional connection between correct base pair sensing and catalytic activation.

In S-AS gene pairs, sense gene usually refers to the protein-coding gene, while the antisense partner can be either coding or non-coding.

Corresponding riboprobe pairs (sense and antisense) were then synthesized (Megascript high yield in vitro transcription kit, Ambion), purified (MEGAClear purification kit, Ambion), resuspended at 100 ng/µl in RNA storage solution (Ambion) and held at −80°C until use.

The Cerulean (kind gift from Dr. Piston, Vanderbilt University, USA) coding sequence was amplified using the following primer pairs: sense primer with a NotI site: 5'- CAGTCCTGCGGCCGCATGGTGAGCAAGGGCGAGGAGCTG -3' and antisense primer with a BamHI site: 5'- TCAGGATCCGAGAGTGATCCCGGCGGCGGTCACG AACTC -3'.