Sentence examples for packaging and envelope from inspiring English sources
The packaging and envelope plasmids were a gift from the Didier Trono Lab, Geneva, Switzerland [55].
In lysates of packaging cells, comparable expression levels of the respective proteins were determined independently from the presence or absence of the packaging and envelope expression constructs.
Briefly, lentiviral particles were produced in HEK293T cells via transfection of packaging and envelope vectors psPAX2 and pMD2.G, respectively.
Control lentivirus was produced by cotransfection of the packaging and envelope plasmid together with the empty pHR-CMV-eGFP plasmid.
Briefly, pLKO.1 vector with a packaging and envelope plasmids were transfected into HEK293T cells using Gene Juice (Novagen).
The lentiviral transfer vector DNA, together with packaging and envelope plasmid DNA were combined at a ratio of 4 1 3 respectively.
Vesicular stomatitis virus G (VSV-G -pseudotyped lentiVSV-G -pseudotypedre obtained by co-transfection of the aboVSV-G -pseudotypedids alentiviralthe particles and envelope-encoding plasmids 2 into 293-T cells, using Lipofectamine 2000 (Invitrogen) and according to manufacturer's instructions.
Transfection with transfer vector, packaging plasmid and envelope plasmid were performed by calcium phosphate precipitate 12 h after planting package 293T cells into 10 cm cell culture dishes.
The lentiviral vectors pLKO.1-puro-scrambled-shRNA (Addgene) and pLKO.1-puro-shRNA (Sigma, sh1061: CCGGCCTAATACTTTCCAGATTGATCTCGAGATCAATCTGG AAAGTATTAGGTTTTT, sh693: CCGGCCAGACCACTACTGAATATAACTCGAGTTATA TTCAGTAGTGGTCTGGTTTT) targeting Bmi1 were transfected into HEK293 cells together with plasmids encoding the packaging (pCMV_dr8_91) and envelope proteins (pMD2-VSV-G) using CaCl2 precipitation.
We used the lentiviral vectors of pHBLV, pSPAX2, and pMD2G, which were a transfer vector, packaging plasmid, and envelope plasmid, respectively.
Transfect 15 cm plate with TOP-GFP lentiviral vector, packaging plasmid, and envelope plasmid with TransIT-293 transfection reagent following Trono lab protocol instructions.
