Sentence examples for outer describes from inspiring English sources

Exact(1)

where n outer describes the number of splits in the outer loop, k the index of the outer loop iteration, and b ^ k, a ^ are different estimates of the regression vector for specific variable subsets.

Similar(59)

OUTER SPACE describes an AREA on the outside of the grid, turning SASH/BEE/LAM/ELS into SASHA/BEER/LAME/ELSA. LIP SERVICE describes a religious MASS on the grid's lip, turning BEA/ARI/HAN/LAST into BEAM/ARIA/HANS/LASTS.

The outer distribution describes all ALPS similarities between pairs of intervals, one annotated as miRNA, the other not annotated as miRNA.

The book's enduring power is also evident in its big-headed tripods from outer space, described perfectly by Wells way back when.

This San Francisco-based troupe, which specializes in the fusion of dance and circus and martial arts, is making its New York debut with "Within Outer Spaces," described as an investigation into the multiple gravitational forces that keep the tumbling earth aloft in its elegant orbit.

Without more information and taking, as I am required, plaintiffs' well pleaded allegations as true, there is a reasonable doubt as to whether the letter agreement meets the admittedly stringent "so one sided" standard or whether the letter agreement awarded compensation that is beyond the "outer limit" described by the Delaware Supreme Court.

A first PCR amplification was performed in a total reaction volume of 50 µL with 1U Taq DNA polymerase (5U/µl, Roche Applied Science, Basel, Switzerland) and the outer primers described by Lombardi et al. [1]: 5'ATCAGTTAACCTACCCGAGTCGGAC 3' and 5 GCCGCCTCTTCTTCATTGTTCTC 3', amplifying a fragment of 730 nt of XMRV gag.

cDNA pools from esophagus, stomach, intestine and liver were prepared from 3 8 μg of total RNA using the ADH8B-specific reverse outer primer described in Table  1.

Like any SEM, PLS refers to two inter-related models [ 76, 78]: a measurement or outer model describing the constructs (latent variables) that make up the model and the relationships between the constructs and their indicators (manifest variables) and a structural or inner model describing the causal relationships among these constructs [ 74, 79].

It is shown that the proposed model describes the outer ionosphere ion composition better than the available models used so far.

In one of many bursts of narrative bravado, he describes the outer borough's desire to see the Yankees, those symbols of excess, taken down by the working-class underdogs: "Roger Clemens enters the batter's box.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: