Sentence examples for optimised version of the from inspiring English sources
For this project, we will measuring performance in terms of the average net speedup between the naive version of the code and the optimised version of the code.
Future research is needed to conduct a definitive randomised control trial with long-term outcomes for the optimised version of the app against a single control group.
Jennifer King, of T-Mobile Online, says: "This is because T-Mobile won't be able to recognise what handset is being used and therefore be able to provide an optimised version of the game".
A future optimised version of the app would also be informed by a content analysis of user feedback received during the trial, which may also help improve the app's acceptability and feasibility to users.
This is followed by the proposal of an optimised version of the method, wherein the strength of the correction term in the momentum balance and energy equations is optimised.
Turing later wrote an optimised version of the program, dubbed the Mersenne Express.
In our future works, we are going to produce optimised versions of the one-to-one DHT for line and circle detections, in order to better promote and spread their use in the community.
The calibration (Hosmer-Lemeshow test) and discriminating validity (area under the ROC curve, sensitivity, specificity, likelihood ratios, predictive values) of the two optimised versions of the PSS will be evaluated.
There will also be a power-optimised version of the chip running at 800MHz, which will consume less power (0.5W instead of 1.9W).
While a plant codon-optimised version of the gene produced a Pr55Gag protein which apparently formed recognisable VLPs (data not shown), the yield of protein was extremely low.
A codon-optimised version of the XI-encoding gene from Piromyces sp. was amplified by PCR utilizing plasmid YeplacHXT-XI as template [ 26]: forward primer 5' GGA GGATCC ATGGCTAAGGAATATTTTCCACAAATTC 3' and reverse primer 5' TTG GAATTC TTACTGATACATTGCAACAATAGCTTCG 3'.
