Sentence examples for operated primer from inspiring English sources
If the diesel engine has no electric primer pump then you can use an electric pump removed from a scrap car or a hand operated primer pump available in most auto factor shops if you do not mind muscle cramps.
The user is able to operate our primer design software in two different modes: targeted search and global search.
Neutrogena Shine Control Primer, $14, walgreens.com.
To confirm the cross-reactivity to the other allele, the allele-specific primer pairs operated against the other allelic vector as the template.
One can easily increase the amount of information about the genome by adding spiddos obtained by another GP operated with a different primer.
Oligo7 software was operated to design these primers (sequences in Table S1, Additional file 7).
Overlapping PCR strategies using multiple independent primers operates on the principle that the chances of detecting the same NuMts with independent PCR primers is low.
In the present study, a more efficient amplification was operated by adding 4 pairs of RCA primers targeting multiple binding sites.
Sequencing reactions were operated on an ABI 3730 48 capillary sequencer of the sequencing service of the Department of Biology of the LMU Munich by using the amplification primers.
Target sequences cloned into pGEM-T Easy were amplified using a T7 primer and a SP6 primer fused with a T7 sequence (TAATACGACTCACTATAGGGATTTAGGTGACACTATAG) to operate as a T7 promoter for in vitro transcription in both directions.
