Sentence examples for one single copy from inspiring English sources

Exact(30)

For one sequenced individual, the TSPY repeat units constitutes ~0.7 MB of DNA on the short arm and only one single copy on the long arm of the Y chromosome [ 48, 50, 51].

However, this was at a LinRegPCR-calculated Cq value equal to 58.2, whereas on the same PCR run, one single copy amplified at a LinRegPCR-calculated Cq value of 56.2, and thus could be easily determined to be an artefactual false positive.

The δ-zeins are encoded by two single copy genes (18-kDa on chromosome 6 and 10-kDa on chromosome 9) and the β-zein is encoded by one single copy gene (15-kDa β-zein on chromosome 6) (Xu and Messing 2008; Feng et al. 2009).

On the other hand, all vascular isolates harbored only one single copy that could be a consequence of their close relatedness.

pLCM2 was generated by inserting one single copy of a FLAG-tag (GATTACAAGGATGACGACGATAAG) in the 3ʹ end of pBBM2.

Using a transgenic mice model where Kit gene was inactivated by the insertion of a nls-lacZ sequence in its first exon, we showed that one single copy of the gene was unable to sustain at a physiological level both spermatogenesis and fertility in the male mice.

Show more...

Similar(30)

We successfully used SB100x for the generation of transgenic lines harboring one single-copy landing site.

One single-copy sequence was used as a reference sequence: 8q11 SST (Single Sequence Tag), mapping at 8q11.

Only one single-copy gene, which is most closely related to CslA/C, was identified in each of the six green algae.

Only two (atpA and psbI) of the 77 genes mapped on the C. reinhardtii and C. moewusii genomes [ 26- 28] moved from one single-copy region to the other.

As can be seen in figure 3, the dynamic range of the hybridizations was adequate to detect and distinguish homozygous and heterozygous loss (chromosome 11p), one single-copy number gain (e.g. chromosome 7p), more then one copy number gain (chromosome 1q) and unchanged chromosome copy numbers (e.g. chromosome 10) in FFPE tumor tissue.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: