Sentence examples for one kilo from inspiring English sources
Mouadamiya resident Abu Malik, whose family of six survives on one kilo (or 2.2 pounds) of rice per day, said that the recent food shipment into the town had caused black market food prices to fall by 90percentt.
One kilo of one-euro coins is worth about €133.
Met Police Flying Squad detectives would regularly nick someone for, say, ten kilos of hash, take nine of them to sell on themselves and just charge the offender with one kilo.
Environmental effect of transporting one ton product per km is 173.3 and environmental effect of producing one kilo steel billet is set at 32.2 based on eco-indicator.
The show, "One Ton One Kilo," was scheduled to open at the Beverly Hills branch of Gagosian on the first Saturday in March.
One kilo-Watt beam power at good yields has been achieved.
However, the high cost, labor-requirements and limitations of DNA fragment length (usually less than one kilo-base) hamper the application of this method in most laboratories.
To produce capture probes for the test array used in Figure 1, a one kilo-base (kb) fragment from the β-lactamase gene was amplified using the same procedure but with plasmid DNA as template and primers GGCACCTATCTCAGCGATCT and GCGGAACCCCTATTTGTTTA.
Legitimate imported caviar requires certification papers and labels on the original one-kilo tins.
