Sentence examples for once sent to from inspiring English sources

The country - even the jihadists we once sent to Guantanamo - is now grateful to America for helping fell Qaddafi.

The fan's photograph, once sent to win Kim's heart, was posted at the rink's entrance like a mug shot.

Cuttings from Hermann were once sent to France, and even to a valley in California called Napa.

I was once sent to find him when he left a meeting at Simon & Schuster to go to the bathroom and was gone for nearly half an hour.

Not surprisingly, she became a troubled teenager, once sent to a juvenile detention home, and pregnant at 14 (the boy baby was prematurely still born).

That bit of theater wisdom, it is believed, was inspired by a directive that George S. Kaufman once sent to the cast of a tryout in trouble.

At the risk of losing some valuable scaffolds when applying our models in virtual screening campaigns, we will choose to avoid acquiring or synthesizing a drug candidate that, once send to pharmacological testing, will prove to be a FP (a drug that was predicted as a BCRP nonsubstrate but which is actually transported by BCRP).

Returning to America to teach philosophy at the Massachusetts Institute of Technology, he also wrote for the New Yorker, which once sent him to Bolivia to write about Che Guevara.

He was arrested once and sent to jail for 10 days for walking around naked.

Britain's ultimatum to Germany, demanding that it withdraw from Poland at once, was sent to Berlin that night.

From the retrieved two DNA sequences, a new primer set (F: AAGTATTAGATCGTTACGGCGATGGAC, R: CCAAGAACACCAATCGTGTTATCAAGG) was designed and once again sent to Eurofins Genomics together with genomic DNA.