Just watch as Grace and Suzie civilly snack on their respective ends of grass.
Later on, depending on the impact point of atmospheric discharges, different time instances, which the travelling waves require to arrive at their respective ends, are determined.
As they repped their respective ends, the crowd revealed their allegiances.
The jury is still out on that; be prepared for many tweets from beneath my desk, which is where I will have assumed the fetal position, should both "Cougar Town" and "Community" come to their respective ends this season.
SPOILER Both Chancellors meet their respective ends while falling down a shaft, eventually exploding in flames.
Apple claims, for instance, that because only the sender and receiver of an iMessage SMS can decrypt the data on their respective devices (end-to-end decryption), their service is NSA-proof.
The KCNMA1 siRNA sequence was derived from Silencer® siRNA (Ambion, siRNA ID: 112882) and constructed as long complementary oligos (KCNMA1si For – cgtacttcaatgacaatatttcaagagaatattgtcattgaagtacgtctttttt and KCNMA1si Rev – aaaaaagacgtacttcaatgacaatattctcttgaaatattgtcattgaagtacg, containing HindIII and BamHI sites on their respective 5' and 3' ends).
An entire cDNA fragment for each of the putative P450 genes was subsequently amplified for both ALHF and aabys house flies by PCR using the primer pair (Table 1) synthesized based on the respective 5' and 3' end sequences of each gene.
After they exercised they would sit on opposite ends of the dining table, silently drinking their respective liquids.
The last two Predator movies earned $128m worldwide on respective $40m budgets.
Unfortunately for the duo, their respective seasons ended on the first day of the competition.
