Sentence examples for on a applied from inspiring English sources
Products were then sequenced with BigDye Terminator v3.1 Cycle Sequencing Kit on a Applied Biosystems 3730S 48-capillary sequencer (Applied Biosystems, Foster City, CA, USA) at NAPS Unit, MSL, University of British Columbia [accession numbers; DDBJ: AB609150 - AB609186, AB625456, and GenBank: HM117701 - HM117719; Table S4 in Additional file 5].
It was 18 August 2003, and I was in Caux, Switzerland, one of 23 participants on an applied peace studies course.
LEDs are semiconductor constructions that rely on an applied voltage to drive electrons and positive carriers called holes through different layers of a crystal sandwich.
The iConnect research consortium has selected several of these projects for in-depth investigation drawing on an applied ecological evaluation framework [ 11].
For example, a book resting on a table applies a downward force equal to its weight on the table.
Sequencing products were resolved on an Applied Biosystems model 3500XL automated DNA sequencing system (Applied BioSystems, USA).
The 42 microarrays were imaged with Cy5 filter sets on an Applied Precision (Issaquah, WA) arrayWoRx™ Biochip Reader.
High-throughput sequencing was carried out on an Applied Biosystems (ABI) capillary sequencer using dye-terminator and fluorescent cycle sequencing with don3 (TCTTGTGCAATGTAACATCAG) and don5 (CGTTAACGCTAGCATGGA) primers.
Oligonucleotides were synthesized via standard automated DNA synthesis on an Applied Biosystems model 394 instrument.
After RT and pre-amplification, quantitative PCR was carried out on an Applied Biosystems 7900HT.
Fragments were separated by electrophoresis on an Applied 3130XL capillary sequencer and quantified using the GeneMarker version 1.6 software (SoftGenetics).
