Your English writing platform
Discover LudwigExact(3)
Otherwise, the old vector (x_i^G ) is retained.
The insertion should be confirmed through 5' sequencing with primer CAAGCGCAGCTGAACAAGCTA (producing 187 bp of old vector + 5' end of the new intron) and/or 3' sequencing with primer AGAATGTAGAATGAACCCATGT (producing 368 bp of the old vector + 3' end of the new intron).
The insertion should be confirmed through 5' sequencing with primer TCGAGCTTAAGaGATCTGTCA (producing 57 bp of old vector + 5' end of the new insertion) and/or 3' sequencing with primer TGACAGATCtCTTAAGCTCGA (producing 10 bp of old vector + 3' end of the new insertion).
Similar(57)
Unfortunately, the accidental announcement of the product in April--somebody in marketing placed an ad prematurely, according to Bob Harputimmediately put a damper on sales of the older Vector 3, backing up millions of dollars in inventory.
ABA Games' creations are "avant-garde" re-imaginings of classic arcade shoot 'em ups, using modern 3D graphics techniques to emulate older vector graphics and employing "imaginative, fresh" gameplay ideas.
From a performance evaluation, Figat, Kornuta, and Kasprzak [21] stated that older vector-based descriptors such as SIFT and SURF (Speeded-Up Robust Features) were being replaced by binary feature descriptors and detectors.
Several oldest vectors are substituted with the same number of the best ones after predefined number of iterations.
The animals were divided in two groups of four age-matched animals: 19.00 ± 1.35 years old (active vector recipients) and 19.75 ± 0.37 years old (control vector recipients), roughly equivalent to 58 years old in humans (Tigges et al., 1988; Gore and Terasawa, 1991; Andersen et al., 1999).
The emergence of BT in parts of Europe never before affected was attributed mainly to climate change and linked to the Northern expansion of the major Old World vector Culicoides imicola.
The phlebotomine sand fly Phlebotomus perniciosus (Diptera: Psychodidae, Phlebotominae) is a major Old World vector of the protozoan Leishmania infantum, the etiological agent of visceral and cutaneous leishmaniases in humans and dogs, a worldwide re-emerging diseases of great public health concern, affecting 101 countries.
This emergence of BT into parts of Europe never before affected was attributed mainly to climate change and was linked to the northern expansion of the major Old World vector Culicoides imicola (Kieffer), which is an Afro-Asiatic species of biting midge (13 ).
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com