Sentence examples for of a fam from inspiring English sources

The three-dye binary probe (BP-3d) consists of a Fam fluorophore which acts as a donor, collecting light and transferring it as energy to Tamra, which subsequently transfers energy to Cy5 when the two probes are hybridized to mRNA.

The copy-number assay detects the target genomic region and consists of a FAM dye-labeled minor groove binder probe and unlabeled PCR primers.

If you're part of a "fam," you'll be able to get into battles pretty quickly.

Basically, the family assist ance plan would guarantee every poor family, even those whose parents had marginal earnings, a minimum income, set at $1,600 a year for a fam ily of four.

MATHEW R. WARREN COMMENT OF THE DAY Fond Recollections Of a Famed Restaurant "My dad once took me to Carnegie Deli on a visit to N.Y.C.

As a control for specificity, we analyzed the uptake of a FAM-Aβ42 peptide that contained the same amino acid composition but in a scrambled sequence.

Deletions in exon 19 were determined by fragment analysis after nested-PCR amplification with the use of a FAM-labelled primer [ 12].

All three ratings are entered into the UKROC software, which generates a graphic presentation in the form of a "FAM-splat" or radar chart, illustrated in Figure 1 [ 31].

Fluorescence polarization curves are shown for the binding of purified proteins to a FAM-labeled 80 bp mrkA promoter fragment (from −117 to −37).

One pair of primers and a FAM 5′-labelled probe were designed inside intron 3 of CFHR3: - forward: TGGGCATTAGTCAAGAATACAGTAAAA - reverse: ATTAATGCCGCTTCAATATGACTTT - fluorescent probe: AATTAGAACACAATACTTGTTGGC. - forward: TGGGCATTAGTCAAGAATACAGTAAAA - reverse: ATTAATGCCGCTTCAATATGACTTT - fluorescent probe: AATTAGAACACAATACTTGTTGGC.

She too is a fam of Temple Grandin (linked above), and with a group of fellow ranchers helped develop a humane mobile harvesting unit.