Your English writing platform
Discover LudwigExact(1)
The initial values of protein parent labels are obtained from the template phylogenetic relations of observed proteins (gene trees) according to their sequences and domain compositions.
Similar(59)
In brief, MODELLER generates the 3D atomic coordinates of the target sequences by satisfying spatial restraints, obtained from the templates, and by CHARMM 23 energy terms enforcing proper stereochemistry.
Using OPA kit, RP1-4, RP-2, RP4-2 and SOY as primers (Table 2), a large number of DNA bands were obtained from the templates of the recombinant yeast strain genomes.
Sequence data obtained from the iMDA template and from both of the genomic templates covered more than 99.98% of the reference genome at least 1X coverage) and greater than 99.9% of the genome with at least 5X coverage.
In Fig. 2, the sequence alignment between the ERev and the best scoring template is shown along with the secondary structures obtained from the model, template structure, and that predicted using Prof. The secondary structure obtained from the model agrees well with the predicted one.
However, uniformity of the size and shell thickness of the hollow silica spheres prepared by the emulsion method are less satisfactory than those obtained from the hard template method due to the dynamic character of the emulsion droplets [23 25].
The mutagenic PCR product was obtained from the pcp015/Cre template by PCR amplification using mutagenic primers MHVCre.for (5'-GTGAGTGCTGACAGGCTTAATAAAGAAAATGATTAAATGAAGTAAAACGACGGCCAGT-3') and MHVCre.rev (5'-GTTGTGTGTAGGAGGTGTGGAAATAAAAACCCTTTAAAATTCAGGAAACAGCTATGAC -3').
Amplification in these controls was never higher than the background obtained from the no template controls.
Basal characteristics obtained from the Utstein template and biomarker levels were compared between these two outcome groups.
However, sequences of the coding genes in this problematic fragment compare favourably with the counterparts obtained from the cDNA templates.
The XF1/XF2 primers amplified a 289 bp product from the parental GD201008-001 and CΔ xf templates while no product was obtained from the Δ xf template.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com