Sentence examples for nts 1 from inspiring English sources

Fig. 3 a XRD patterns and b Raman scattering spectra of bare TiO2 NTs (1), 10-cycle ZnO/TiO2 NTs (2), and 25-cycle (3) ZNTsTiO2 NTs.

Fig. 5 UV visible absorption spectra of bare TiO2 NTs (1), 10-cycle ZnO/TiO2 NTs (2), and 25-cycle (3) ZNTsTiO2 NTs. Figure 6a shows the PL spectra of the samples measured at 300 K.

Fig. 9 Transient PC densities of bare TiO2 NTs (1), 10-cycle ZnO/TiO2 NTs (2), and 25-cycle (3) ZNTsTiO2 NTs under illumination of light with wavelength cutoffs of 380 nm (a) and 420 nm (b).

Fig. 6 PL spectra of bare TiO2 NTs (1), 10-cycle ZnO/TiO2 NTs (2), and 25-cycle (3) ZNTsTiO2 NTs measured at 300 K (a) and 20 K (b).

Construct Sps6 which encodes nts 1 to 763 including both SP1 sites, showed 80-90% expression strength of the control vector.

In contrast, Sps7 which encodes only nts 1 to 683 and lacks one essential SP1 binding side, completely lost promoter functionality.

Fig. 2 a RBS spectra of bare TiO2 NTs, 10-cycle ZnO/TiO2 NTs, and 25-cycle ZnO/TiO2 NTs.

The optical absorption spectra of the TiO2 NTs, TiO2(NTs NTs, BiVO4/TiO2 NTs, and the BiVO4/TiO2(NTs NTs are shown in Fig. 5.

Open image in new window Fig. 5 Photo-absorption spectra of the TiO2 NTs, TiO2(NTs NTs, BiVO4, BiVO4/TiO2 NTs, and the BiVO4/TiO2(NTs NTs, respectively.

Regulation by RNA silencing can occur at either the transcriptional or posttranscriptional level, although in both cases, silencing is associated with formation of small RNA classes with typical sizes of 21 and 24 nucleotides (nts) [1] [3].

HIV-1 specific primers M661, CCTGCGTCGAGAGAGAGCTCCTCTGG (nts 695 672) and M667, GGCTAACTAGGGAACCCACTG (nts 496 516) were used to detect complete cDNA.