Sentence examples for not successfully generated from inspiring English sources

In cases where a 650 bp product was not successfully generated, internal primer pairs (LF1 ANTMR1-(see Table 1)) and (MLF1 – GCTTTCCCACGAATAAATAATA [11] – LR) were employed to generate shorter overlapping sequences that allowed the creation of a composite sequence (contig).

This method did not successfully generate bacterial isolates which could metabolise palm olein to produce PHA.

Here, 68 molecules were eliminated because some molecular descriptors of them could not be successfully generated by Molecular Operating Environment MOEE) 2009 molecular simulation package [17], and 3 molecules with pLD50 values higher than 7.0 or lower than 0, distantly distributed from the other data, were removed.

Strikingly, not all successfully generated mice have been reported in the literature.

Successful double transformants were obtained for all combinations of genes as confirmed using genotyping and RT-PCR, except for the strain TPS-N with addition of CfDXS in neutral site 2, which could not be successfully generated and was therefore left out of the study.

Although the above set of studies suggest an important role for BbCRASPs in spirochete immune evasion, the precise role of individual BbCRASPs, or their orchestrated role in the B. burgdorferi infection cycle is not clear, largely because infectious BbCRASP-deficient B. burgdorferi have not yet been successfully generated [14].

Consequently, not only it extracted known design information but also it successfully generated design strategies not to extract from the database.

After 8 to 10 days of culture, the DN4 cells from B6 mice, but not those from CD1dKO mice, successfully generated αGC/CD1d dimer+ NKT cells (Figure 2A).

Importantly, the chosen PNS regime successfully generated measurable stress hormone enhancement, but did not elicit significant confounding pre- or post-partum behavioural defects in the treated dams that may have influenced subsequent phenotypic testing of the offspring.

Fully segregated PSI, PSII and Chl biosynthesis mutants were successfully generated in this genetic background and some of these mutants could not be obtained in other substrains.

Note, that although we don't know where and how these disulfide bonds are generated, we have at this point successfully generated tetramers from HLA preparations representing 14 different HLA alleles, and in no case have we failed.