Sentence examples for normalized strand from inspiring English sources

Different values than those used here for RSC or normalized strand correlation (NSC) coefficients may be needed for such genomes, and this is a topic for future investigation.

Using normalized, strand-specific libraries, we sequenced pools of all BMSB life stages on the Illumina HiSeq.

The normalized single strand cDNAs were converted to double strand cDNAs and were amplified by Failsafe™ PCR system (Epicentre Biotechnologies, USA) using single amplification primer (CAGTGGTATCAACGCAGAGT) for which the binding sites are present only in the tester cDNA (underlined in tester3 and tester5 primers used for cDNA synthesis).

The normalized single strand cDNAs were converted to double strand cDNA and amplified by FailsafeTM PCR system (Epicentre Biotechnologies, USA) using amplification primer (CAGTGGTATCAACGCAGAGT) for which the binding sites are present both in the 5' and 3' end of the cDNA and it is specific to the tester cDNA only (underlined in tester3 and tester5 primers used for cDNA synthesis).

cDNA was normalized after reverse transcription to obtain a balanced mix of low and high abundance mRNA, as previously described [ 59]. 2.1 micrograms of normalized, double-strand cDNA were then converted to a single strand library using the 454 protocol [ 46].

After reverse transcription, the cDNA library was normalized to obtain an equilibrated mix of low and high abundance mRNAs using Kamchatka crab double-strand nuclease (DSN) [ 29], as described in Additional file 1. 2.1 μg of normalized double stranded cDNA was sheared by nitrogen nebulization following the manufacturer's instruction (Roche, Basel, Switzerland).

Approximately 1 μg of normalized double stranded cDNA was used for 454 pyrosequencing.

The qPCR array consisted of panels of normalized first-strand complementary DNA (cDNA) from 18 different pathologist-verified human cancer tissues (with cancer stage ranging between I to IV).

To revise the in silico annotations and validate them with experimental data, we combined the normalized and strand-specific reads with the complementary, highly abundant short reads and visualized them using the GeneScapes genome browser.

The Ic results of the cable show no degradation when normalized to the strand.

To prevent any empty vectors, A Not1 oligo and Taq polymerase were used to synthesize double stranded DNA from the single stranded normalized library.