Internal standard is an element used to normalize the results and to overcome instrumental oscillation.
Step 6 Calculate the midpoints of the intervals and normalize the results in order to find the weights.
After superimposing the models on every candidate in the test image, we normalize the results which will be used as the fingertip probability map for tracking.
Thus it is necessary to normalize the results on a user by user basis with the baseline in order to obtain reliable results.
For this purpose, we first determine the total pore length obtained from Eq. 5a and normalize the results for the sake of comparison.
To address this challenge, the present study introduced a novel method to normalize the results from projection studies according to different baseline and projection periods and climate scenarios, thereby facilitating comparison and synthesis.
we calculate the norm of residual ||r(l)||2 and the grid error | ĝ ( l ) - f |, and normalize the results with ||r(0)||2 and | ĝ ( 0 ) - f |, respectively.
DMSO treated cells were used to normalize the results.
The endogenous housekeeping gene β-actin was used to normalize the results.
Five house-keeping genes were used to normalize the results and the whole experiment was repeated four times.
House keeping gene Rpl-11 (Forward, CCATCGGTATCTATGGTCTGGA and reverse, CATCGTATTTCTGCTGGAACCA) was amplified and used to normalize the results.
