Sentence examples for nomenclature consistent from inspiring English sources

Using nomenclature consistent with that study, we employed the following primers: GSP 1, ACCCTTCTTCTAACGGC; GSP2, TTTCGTGCGGCAAACGAAGTC; and GSP3, TGAATTCATCTCAAATCTCG.

In the following, we deploy nomenclature consistent with [ 2].

In addition to funding, the nascent discipline of inpatient glucose management will benefit from standardized nomenclature, consistent and meaningful metrics, and transparent study designs and analytical methods allowing for comparison of study outcomes.

†In addition to the common gene name, these loci are allocated a value-free nomenclature consistent with the FAM18 genome annotation but using the prefix NEIS instead of NMC.

In addition to the common gene name, these loci are allocated a value-free nomenclature consistent with the FAM18 genome annotation but using the prefix NEIS instead of NMC (Table 3, Appendix).

Taste receptors (hereinafter referred to as TRs) and their genes (Tasrs, nomenclature consistent with the review by Bachmanov and Beauchamp [ 9]) are known to monitor the presence of dietary compounds in the oral cavity.

This nomenclature remained consistent: Modern day musicians from Yo-Yo Ma to Britney Spears talk about pitch names the same way Handel and his contemporaries did.

By relating all vegetation plots to this updated list, we ensured that the nomenclature was consistent.

This nomenclature is consistent with other EFC domain structures that have a short helix (α1) that is either disordered or missing in the Syndapin EFC domain.

Chromosome nomenclature was consistent with the previous naming system [ 20].

Our chromosome nomenclature is consistent with earlier reports by Fukui et al. [ 22], and these have been reinforced by Snowdon et al. [ 23] and Koo et al. [ 24].