Sentence examples for no complementary sequences from inspiring English sources
The RNA octamers contain no complementary sequences and stabilizing interactions between RNA molecules I and II arise through the formation of intra and intermolecular base stackings and non-canonical base-pairs, resulting in the formation of 'kissing' loops (Figs. 1B and 1D, and Fig. 3).
Interestingly, for more than half of these miRNAs*, no complementary sequences (such as miR-959* and miR-133a*) were detected.
The target sequence for silencing the Tnfrsf1a gene [EMBL: M60468] was ATCTTCGGTCCTAGTAACT (base pairs 1095 to 1113), and we used ACTCATGTCTTGATCAGCT (no complementary sequence in murine genome) as scrambled control sequence.
When a non-negligible Doppler shift is induced by the target motion, the waveform matrix formed from the complementary sequences is no longer unitary, resulting in significantly degraded target range estimates.
A probe specific for U6 snRNA (cacgaatttgcgtgtcatcctt, predicted Tm ~ 84°C, Exiqon) was used as positive control, and a 22-mer scrambled probe with a random sequence (gtgtaacacgtctatacgccca, predicted Tm ~ 87°C) having no known complementary sequence target among human transcripts performing MegaBLAST search at NCBI GenBank, was included as negative control.
Using hybridization, a single-stranded DNA molecule can capture complementary sequences from any source.
Under the optimum conditions, the suggested biosensor revealed high selectivity for discriminating the complementary sequences from non-complementary sequences.
In addition, the mentioned biosensor was satisfactorily applied for discriminating of complementary sequences from non-complementary sequences.
Zanchetta, G. Spontaneous self-assembly of nucleic acids: liquid crystal condensation of complementary sequences in mixture of DNA and RNA oligomers.
It shows excellent selectivity against non complementary sequences and 3 base mismatch complementary targets.
The sequences of the two oligonucleotides comprising the barcode adapter are: 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxxxx and 5′-AGCTyyyyyyyAGATCGGAAGAGCGTC2GTGTAGGGAAAGAGTGT, where "xxxxxxx" and "yyyyyyy" denote the barcode and barcode complementary sequences.
