Sentence examples for ng were placed from inspiring English sources

Exact(1)

Two different concentrations of CCL21-vaults (200 ng and 600 ng), empty vaults (600 ng), and recombinant CCL21 (600 ng) were placed in the bottom chamber of a 24-well transwell plates and 2×105 T2 cells were added to the upper chamber.

Similar(59)

DNA (ca. 10 ng) was placed into wells of 96-well plates and dried at room temperature over several hours.

RNA (500 ng) was placed in a 200 uL tube along with two uL of either Diluted Spike A or B and 1.2 uL of T7 Promoter Primer Mix.

A weighed quantity of a mixture of ATR and NG was placed in a mortar, and the mixture was kneaded thoroughly for 20 minutes with ethanol (1.5 times the amount of mixture).

The comparison of the different voltammetric behavior in the presence of the different acidic and basic additives allowed constructing an acidity level scale where the different acid base couples of the intermediaries of the NG electroreduction were placed.

Cells (A431) labelled with 10 ng ml−1 DInvitrogenogen) (3.8 × 10 ml−1) were placed in the top compartment of a fluoroblock 24-multiwell insert plate, which was separated from the bottom compartment by a Matrigel (25 mg -coated fluoroblock mg -coatedith 8.0- μm pore size.

Peptide samples (∼20 ng) in 1 μL of buffer were placed onto freshly glow-discharged carbon films on 300 mesh nickel grids for 2 min and blotted with filter paper.

To do gene disruptions, 50 μl of electrocompetent cells and 3 μl (150 ng) of the linear PCR product were placed in a BioRad gene pulser 0.1 cm gap electroporation cuvette.

Briefly, 10 ng of sample DNA(1 μl) were placed in 4 μl of reaction solution containing: 2.5 μl of the 2× TaqMan® Universal PCR Mix Applied Biosystemss), 0.25 μl of predevel ped assay reagent from the SNP genotyping product(20×) (Applied Biosystems) containing two primers and two MGB-Taqman probes, and 1.25 μl of distilled water.

To each slide, 60 μl of hybridisation buffer containing 120 ng of probe and 60 ng of DAPI were added and cover slips were placed.

daf-16 primers: forward: CTTCAAGCCAATGCCACTACC reverse: GGAGATGAGTTGGATGTTGATAGC. act-1 primer set: forward: GAGCACGGTATCGTCACCAA; reverse: TGTGATGCCAGATCTTCTCCAT. Synchronized worm eggs were placed on master NG-carbenicillin plates seeded with the indicated RNAi bacterial strain and supplemented with 100 m m IPTG.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: