Your English writing platform
Discover LudwigSuggestions(1)
Exact(27)
cDNA (100 ng) was mixed with a control oligo to monitor tail length and water in a total volume of 33.5 µl.
Briefly, GST-CypA (100 ng) was mixed with 10 ng of NS5A-His in a total volume of 200 µl for 3 h at 4°C on a rotating wheel.
The full length (FL) Math5 IVT RNA product (10 ng) was mixed with DNaseI-treated mouse liver RNA (3 µg) or used directly (10 200 ng) for RT-PCRs.
The purified kinase (100 ng) was mixed with 2 mg histone H1 Upstate), 4 ml of 5× kinase buffer(100 mM Tris, pH 7.4, 50 mM MgCl2, 2.5 mM DTT), 0.5 mCi gamma-32P-ATP, the indicated amount of chemicals and water to a final volume of 20 ml.
The plasmid (100 ng) was mixed with competent cells prepared from a 1 mL LB culture.
BSA-alkyne (200 ng, 50 ng, 40 ng, or 30 ng) was mixed with Jurkat cell lysate (20 μg).
Similar(33)
Serial dilutions of in vitro transcribed infectious RNA (10, 1 and 0.1 ng) were mixed with lipofectin (Invitrogen) as indicated by the manufacturer.
The known amounts of Vela or Imig standard (0.5 6 ng) were mixed with serum aliquots or tissue lysates from saline-injected 9 V/null mice and loaded onto each gel for quantification standards and as background controls.
Purified TFIIB (0.6 pmol), TBP (0.6 pmol), RNA pol II (0.3 pmol), TFIIF (1 pmol), and mediator (about 0.1 pmol or 200 ng) were mixed with 0.5 1.0 ng of 32P-labeled DNA probe in the presence of 20 mM Hepes, 10% Glycerol, 60 mM KCl, 4 mM MgCl2, and 4 mM DTT in a 15 µl reaction.
A mixture of Cy-3 and Cy-5 labeled products (250 ng) were mixed for each time point, diluted in 60 µl Agilent hybridization buffer, and hybridized at a temperature of 60°C for 17 hours in a dedicated hybridization oven (Robbins Scientific, Sunnyvale, CA).
The same quantity of both ribo-seq and mRNA-seq fragments (usually 100 ng) were mixed with 1 10,000 of unspecific RNA oligonucleotide 5′AUGUACACGGAGUCGACCCGCAACGCGA 3′ which serves as a 'spike-in' control.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com