Sentence examples for ng of tissue from inspiring English sources

However, the µFBI only required 200 ng of tissue lysates, compared to 20 µg in the standard bead-based assay.

This setup allows the simultaneous detection of several parameters and only requires 200 ng of tissue lysate in a 1 µL assay volume.

In total, 10 ng of tissue genomic DNA and two kallikrein 6 primer sets (5′-end primer set: 5′-ACCCTCCAGCCCATACCAAC3′ and 5′-ACATGGGAAACCACAGGCA-3′; and 3′-end primer set: 5′-GGACGCAAAGAAAGGGCAG-3′ and 5′-CCACCTCGTGTCTTGAGGACA-3′) were used in the genomic qPCR reactions.

Tilapia samples (2.5 g) were placed into polypropylene centrifuge tubes and the appropriate volume of a working LMG solution (1 μg ml−1) was added to produce concentrations at 1.0, 12.0 and 25.0 ng g−1 of tissue.

As reported in Table 1, in control brain samples, the average amounts of 27-OH and 24-OH recovered were about 0.2 and 2.5 ng mg−1 of tissue, respectively.

For each sample, a 20 μl reaction was set up in LightCycler capillaries containing 1 μl of 100 ng of leaf tissue TNA was added to 4 μl LightCycler ® FastStart DNA MasterPlus SYBR Green I (Roche), 1 μl forward coat protein primer (10 μM) 5′ACGTCCGTCGCAAGTACGAT3′, 1 μl reverse coat protien primer (10 μM) 5′ATTGTCATGTCGAATAGTACG 3′ and 14 μl nuclease-free water.

Results were expressed as ng 11-KT/mg of tissue.

Concentration of interleukin-1 β in duodenal mucosa was expressed as ng per g of tissue.

It appeared that a significant tumour response could be obtained when the intra tumoral concentration of mhATF-BPTI was above 400 ng / g of tissue.

Fluorescence spectroscopy was sensitive enough to detect D-Cy5 in brain samples at concentrations of 1 ng per gram of tissue.

Loai et al. determined the optimal VEGF dosage, 2 ng VEGF/1 g of tissue for mouse, which is necessary to vascularise implanted BAM and which gives the positive correlation between angiogenesis and fibrosis [ 24].