Sentence examples for newly situated from inspiring English sources

Based on observed changes in design focus largely due to the widespread availability of technology, design research and its role in education and practice need to be newly situated.

Now that he is newly situated in his own Brooklyn studio, he'll definitely be making more of his custom bike configurations (see his "F*ck Bike") among other metal bending discoveries, " I've always been into material mashups," he explains, "I started welding at 16, and metal became a gateway drug to all sorts of new possibilities".

Tandem versions were generated by digesting EcoRI/Xba and inserting an additional linker (AATTTTGTCTTCCTGATCGGCGCCGCAGGAATACTCTTCGTATCTAGAGTGAATTCCTAA, newly situated restriction sites Xba-EcoRI are underlined).

I find that the similarly situated, newly emancipated parents I encounter usually fit into two groups.

The clustering of the isoenzymes according to their codon usage frequencies situated newly discovered isoenzymes with most divergent sequence and gene structure (HRP_3523, HRP_5508, HRP_22489, HRP_17517, HRP_23190) also furthest away from the previously known group C isoenzymes.

The main objective of this study was to investigate the feasibility of SCO2 injection for enhanced gas recovery for a newly discovered gas field situated in the North West Shelf of Western Australia.

The center of the newly classified depression was situated on the western edge of deep convection.

A newly discovered sRNA (EcsR1), situated within the IGR between the uspF – ompN genes in E. coli, is absent from Salmonella due to the translocation of a genomic segment containing the ompN gene.

All three firms, staffed by former high-ranking state officials, have offices in Trenton, which is where the newly created group will be situated.

Their newly created homes will be situated along the entry bridge and within the sculpture court of the Marcel Breuer-designed museum.

To that end, Ptolemy III (246 221 bce) incorporated the branch library into the newly built Serapeum, which was situated at a distance from the royal quarter in the Egyptian district south of the city.