Sentence examples for nested with the from inspiring English sources

Special strategies have been developed to effectively minimize the on-line computational effort, in which the progress of the optimization iterations is nested with the progress of the process.

In clade I, 7 aspergilli FAEs sequences form a well-confirmed group nested with the one sequence of the penicillium genus.

We also test earlier suggestions that bustards and sandgrouses may be nested with the charadriiforms.

CgNR1CDEFα and CgNR1CDEFβ associated with the MgNR1DEF and nested with the NR1C, NR1D, NR1E and NR1F groups.

Numerical evaluation in count models is facilitated by the fact that most models are nested with the Poisson model.

While in one clade the fish PKR genes were nested with the PKZ genes, the other clade contained the PKR genes of all other vertebrates.

Soil samples were collected from 5 m × 5 m subplots nested with in the 10 m × 10 m at the center of the main plots.

Following initial screening of primers to achieve the highest diversity in lengths for all the isolates, the primers used were: RACEK15'2 (5'AATGGCGGCGCGTAGGTAGACTCT3') for the 5'end, nested with NESTEDK15'2 (5'CCCGTTGGTCandGGAAGAAGGGT3') and RACE13'2 (5'TCGATGAGAGTCTACCTACGCGCC3') for the 3'end, nested with NESTED15'2 (5'ATTGCGCAATACATGGCCACGGTG3').

The HBV genotype was determined by nested PCR with the Qiagen Mini Kit (Qiagen), following the manufacturer's instructions.

The ID of the source colony of the fungus gardens and the pupae was included as a nested variable with the replicate subcolonies nested within.

As above, the ID of the source colony of the fungus garden and the pupae was included as a nested variable with the replicate subcolonies nested within.