Sentence examples for name sequence from inspiring English sources

For further information (species name, sequence, etc).

Table 1 Sequences of oligonucleotides employed in this work Name Sequence A1: anti-E.

In publications, authors may choose to concatenate the allele name, sequence variant suffix, and the germplasm source to avoid undue repetition for the readers.

Sequence name Sequence description Type of motion Diving Springboard diving sequence Camera panning motion Basketball Basketball sequence High motion Fence From "digital video essentials" [16] test material.

Table 1 Polymerase chain reaction primer sequences and their amplicon sizes Primer name Sequence (5′-3′) Amplicon size IS 6110 F CCTGCGAGCGTAGGCGT 123 bp IS 6110 R CTCGTCCAGCGCCGCTTCGG MPB64 F TCCGCTGCCAGTCGTCTTCC 240 bp MPB64 R GTCCTC GCG AGT CTA GGC CA Protein b F ACCACCGAGCGG TTCGCCTGA 419 bp Protein b R GATCTGCGGGTCGTCCCAGGT.

Table 1 Oligonucleotide sequences and nomenclature   Name Sequence Probe Mod-Ph HS- (CH2 6 -5′- GCT GAA GGG CTT TTG AAC TCT GCT-3′ Target P1      5′- AGC AGA GTT CAA AAG СCC TTC AGC-3′ Target Bcrex14      5′- CCA CTG GAT TTA AGC AGA GTT CAA-3′ Target TC      5′- GCT ATC AGC CAC GAA CAC CCA-3′.

Gene locus, protein reference number, given name, sequences of primers used for PCR amplifications and molecular mass of recombinants are depicted in Table 1.

An integrated indicator named sequence difficulty degree (SDD) is proposed by combining these five metrics to intuitively represent the sequence-level tracking difficulty of the infrared image sequence.

Since 2002, subtropical storms have been assigned names from the same naming sequence as tropical storms.

Two subclasses of Motif were also created, named Sequence Motif and Structural Motif (Fig. 1).

The objective function, named sequence specificity, is defined in [ 7] as follows.