The designed SSR primer pairs were denominated as the names of sequence scaffolds followed by a serial number of microsatellites (such as BrScaffold000001_1).
The Simple search option allows users to query any field of the database entries (protein ID in the source database, FixPred ID of the corrected sequence, protein description, database source, species name, type of sequence error identified by MisPred).
The simple search option allows users to query any field of the database entries (protein ID of the source database, protein description, database source, species name, type of sequence error identified by MisPred).
Ideally the sequence should be in Fasta Format which means the name of the sequence should begin on a line starting with '>', the greater than sign, followed by the name details.
Representative sequences for SUP05 and Arctic96BD-19 clusters are labeled 'SUP05_cluster number' followed by the name of the sequence according to NCBI.
Name of primer Sequence Sp1-f gagaaaacagcccagatgc Sp1-r cccttccttcactgtcttt VEGF-f agggcagaatcatcacgaag VEGF-r gtctcgattggatggcagtag CyclinD1-f cgtggcctctaagatgaagg CyclinD1-r tgcggatgatctgtttgttc Bcl-2-f acaacatcgccctgtggatgac Bcl-2-r atagctgattcgacgttttgcc Survivin-f ggaccaccgcatctctacat Survivin-r gttcctctatggggtcgtca.
We identified the metadata by analyzing the strain name of the sequence such as A/chicken/Egypt/1/2008.
The name of the sequence includes the patient name, a unique identifier, the genotype and the absolute frequency (number of reads).
This five-column-table is displayed at the bottom of the pages containing date of submission, name of the sequence, real-time status (if parallel processes are submitted) and the link to the result page.
The « Summary » option provides the NCBI-GenPept accessionumberer and the Uniprot accession number, the name of the sequence and of the organism, the putative function of the LEAP (if any).
