Sentence examples for n represents an from inspiring English sources

The values 0-3 represent leaf nodes z,u,k,s in that order, while any other value n represents an internal node with children represented by the 32-bit integers stored in linear memory at n and n + 4. We encode the tree so that address 4 holds the root of the tree.

I N represents an N×N identity matrix.

where I n represents an n×n identity matrix.

I n represents an n × n identity matrix and 1 n is an all-one column vector with length n, while 0 n is an all-zero column vector with length n.

"N" represents an uncertain nucleotide which is definitely present and "*" represents an optional nucleotide.

When searching for ER binding sites, in addition to predicted TFBSs as described above, information from TRANSFAC [41] and pattern search implementation using 3 consensus sequences, TCGACGCTTTCAAGGTCATATCCG, TCGACAAAGTCAGGTCACAGTGACCTGATCAAG and GGTCANNNTGACC, where 'N' represents an arbitrary nucleotide, [9], [42] were also utilized.

For KYSE cell culture, each "n" represents a distinct passage.

For cardiac fibroblast cultures and animals used for experimental obesity and insulin resistance, each "n" represents a distinct biological replicate.

h(n) represents a low-pass filter, and g(n) represents a high-pass filter, which are determined by the type of the selected wavelet.

where s2(n) represents a mixture of all sources except the first one s1(n).

where x(n) is the original signal and x ^ ( n ) represents a reconstructed signal.