Sentence examples for mutations we amplified from inspiring English sources

To sequence the somatic mutations, we amplified and cloned DNA of patient 2 PBMC and T cell DNA of both brothers.

To assess the nature of the rosy mutations, we amplified and sequenced the target sites in F1 flies.

To estimate the frequency of untargeted mutations, we amplified and sequenced a portion of the targeted region of many different recombinants.

To identify the nature of the EMS mutation, we amplified and sequenced overlapping segments of capt from genomic DNA of punctate and compared it to the WT capt sequence.

In order to identify the cre1.1 mutation, we amplified and sequenced the cre1 locus in strain RUT C30.

To detect the pol2-4 mutation, we amplified a 481 bp region of the POL2 gene using primers M32-m, 5'TCCGAGTATCTATAGACAAGGA and M36, 5'CTCACCTTCAGCATCTGG.

To identify the sc mutation, we amplified and sequenced the exons of all 11 genes within the 1.25 Mb mapped region.

In order to check whether all SP04B clones present in this library included this mutation, we amplified the SP04B gene with primers flanking the CDS, the cDNA library as a template, and further sequenced the extracted DNA.

To genotype the fancm mutation we amplified using the following primers: fancm1dCAPsF1 5′-ACAATATATGTTTCGTGCAGGTAAGACATTGGAAG-3′ fancm1dCAPsR1 5′-CACCAATAGATGTTGCGACAAT-3′ The resulting PCR product was digested with MboII, which yields a ∼215 bp product for wild type and ∼180 bp for fancm (Crismani et al., 2012).

To verify observed mutation events, we amplified microsatellite fragments twice for the parents and offspring involved in these cases.

To test this, for each of the five common mutations, using PCR we amplified and resequenced the region from the first time point of each lineage (frozen immediately after transformation).