Sentence examples for mutations interfere specifically from inspiring English sources

While evidence is emerging that gamma subunit mutations interfere specifically with AMP activation, there remains some controversy regarding the impact of gamma subunit mutations [1] [3].

For the implementation of the method, we used two different means to interfere specifically with protein synthesis.

RCL mutants designed to interfere specifically with the polymerization mechanism also show an atypically decreased rate.

Briefly, the oligonucleotide GGAGGACTATCCAGGCATTGT was designed to interfere specifically with ERGIC3 gene expression.

Karkkainen, M. J. et al. Missense mutations interfere with VEGFR-3 signalling in primary lymphoedema.

Other genetic mutations interfere with the cell's normal life cycle, especially the cell-division cycle.

Thus, it might be possible that FUS mutations interfere with this interaction and might impair this feed-forward loop.

(B ) Several parB mutations interfere with efficient chromosomal loading of Smc ScpAB.

But the same reproductive check is not there to quell the accumulation of mutations interfering with fertility in middle age.

Mutations interfering with apoptotic signaling/execution are strongly selected for in Myc-driven tumorigenesis.

How might the A66W mutation interfere with eye development?