Sentence examples for mutations in each from inspiring English sources

Exact(60)

The several hundreds to tens of thousands of somatic mutations in each cancer, therefore, potentially allow much greater resolution of mutational patterns and insights into underlying mutational processes.

(B ) Context of the genome wide mutated C bases in yeast AID/APOBEC transformants with total numbers of mutations in each dataset indicated.

As a control, a mutated version of this promoter was synthesized (Medigenomics) to contain four point mutations in each SRE element as previously reported [49] (AAAAGAACCCCTATGCAAACTCCTCCCCCTGC, mutations underlined).

The number of mutations in each cancer catalog affects the ability to decipher signatures of mutational processes.

The Makona strain of the Ebola virus, which was responsible for the recent west Africa outbreak, contains an estimated 16 to 27 mutations in each copy of its genome.

The most frequent mutations in each dataset were relatively common, validating our approach.

These data indicate that particular mutations in each of variants can strongly affect the protein stability.

Mutations in each of these DHFRs can result in resistance towards clinically relevant antifolates.

The possible combination of mutations in each tumor clone is enormous, making each tumor genetically unique.

Two restriction sites were created for those mutations in each segment, Fsp I and Dra I, respectively.

A precision genomic medicine approach is dependent on an enhanced understanding of driver mutations in each subtype and stratification of patients according to their genetic drivers.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: