Sentence examples for mutations are underlined from inspiring English sources

EMSAs were performed based on a previously established protocol [46] using an oligonucleotide encompassing the Stat-binding site of the mouse Cdkn1b promoter in wild type form (5'-TTAATTTCCTGTAACATG-3') or in its mutant form (5'- TTAATTGTCTGCGACATG-3'; mutations are underlined) as reported [18].

Codon-changing mutations are underlined.

Transversions are further specified; ins and del denote insertions and deletions of nucleotides, respectively; back mutations are underlined; symbol < denotes parallel mutations; heteroplasmies are labeled using the IUPAC code.

The latter domains are encoded by A exons with homologous defective splice donor sites directly followed by two in-frame stop codons (AT T AGTGA GG to A and G to T mutations are underlined; stop codons in bold letters) (Additional File 2, part B).

As a control, we used the synthetic oligonucleotides with mutations in the two essential nucleotide sequences required for BBP/SF1 binding (UAC AA UC; the mutations are underlined) (Berglund et al. 1997).

The sequence of the mutant was found to be: CACTTTAGTTACAACATATTTATT The site of the mutation is underlined.

The nonsense mutation is underlined.

Sequence deleted by gk367 mutation is underlined in red.

10 A PPAD oligonucleotide with a point mutation at the Cys codon at position 351 in PPAD replacing Cys with Ala was designed using the 5′ and 3′ ultrapure primer pair (HYPUR-grade from MWG Eurofins)—atgccctgcat gcccgtactcacgag and ctgttcctaaccaaggtgttcctgaag, respectively with 5′-phosphorylation (mismatch in forward primer creating point mutation is underlined).

Mutation sites are underlined.

Parasites with mutant dhps haplotypes are restricted to sub-Saharan Africa, and parasites with the A437 G, K540 E, and A581 G mutations (mutant amino acids are underlined), which are known as dhps triple mutants (haplotype S GEG across codons 436, 437, 540, and 581), have been limited to eastern Africa.