The numbers of the mutated sequences and the mutations are shown below each bar graph.
The DNA sequences used as probe or as cold competitor are the following (mutations are shown as lowercase letters): 5′- AGAATCAGACATCTGTTCTGA ATGACA −3′, 5′ T GTCATTCAGAACAGATGTCTGATTCT-3′ (ARE); 5′- AGA ATCAGACATCTaccCTGAATGACA-3′, 5′- TGTCATTCAGggtAGATGTCTGATTCT −3 (mutated ARE).
A table of mutated residues and some of the spectra obtained for the individual mutations are shown in the following figures.
The target sequence is shown in blue, and mutations are shown in red.
Copy-number losses are shown in blue, and mutations are shown in green.
Activating HER2 mutations are shown to confer resistance to ER-directed therapies in patients with ER+ metastatic breast cancer.
The mutations are shown for individual patients in Fig. 2 along with data on PAM50 subtype and previously reported IHC status for ER, PgR, PTEN, Ki67 and HER2 (FISH as necessary).
TERT promoter mutations are shown to correlate with elevated mRNA expression, supporting a role in telomerase reactivation.
The mutations are shown in Fig. 1C and the primers used for mutagenesis in Table 1.
Representative electropherograms and restriction enzyme digestion assays for the novel mutations are shown in Figure 1.
The primers used to introduce processing site and protease mutations are shown in Table 1.
