Sentence examples for mutation were identified from inspiring English sources
Five patients with MEN1, including our patient who has an MEN1 gene mutation, were identified within his family.
Mixed plaques containing the mutation were identified by MAMA-PCR, and from one of these, individual plaques containing the mutation were isolated on the suppressor strain (see Table 3).
Coding microsatellite (cMS) containing sequences likely to be NMD-resistant upon mutation were identified using a computer program written in the Python language (http://www.python.org) using the BioPython library of Python functions (http://biopython.org).org
A mutant, here termed arp-1, with an R354W substitution in a conserved site was obtained through the TILLING procedure (Fig. 1)[8], and strains containing the mutation were identified by treating a PCR product, synthesized with forward ("Arp7", 5'andGTTGAAGTTTGAGAGCTTC3') and reverse ("Arp10", 5'TAAGTGTAACCGACAACACCAG3') primers, with NlaIII restriction enzyme.
The male and female offspring with WT/c.451C>T mutation were identified by PCR.
V600R mutation and double (V600E-V600M) mutation were identified in two melanomas.
The real benefit of the research will come if and when the mutation is identified in other individuals.
Different types of auto-ignition and pressure mutation are identified with various initial temperatures.
No amino acid changing mutation was identified.
APOE Kyoto mutation was identified.
No mutation was identified in exon 1.
