Sentence examples for mutation were amplified from inspiring English sources
Fragments in regions suspected to contain the mutation were amplified by PCR and sequenced.
Myc-tagged full length KREPA3 WT and mutant genes with one or both zinc fingers mutation were amplified from the plasmids pLEW79-A3-TAP, pLEW79-A3ZFm1-TAP, pLEW-A3ZFm2-TAP and pLEW79-A3ZFm1&2-TAP [49], respectively, by using the primers 5'-CCTCGAGCCACCATGAAGCGTGTTACTTCAC-3' and 5'-ATTCATGATCACAGGTCTTCTTCAGAGATCAG-3'.
Selected variant regions (~125pb flanking the identified somatic mutation) were amplified and PCR products were sequenced on the Ion PGM Sequencer (Life Technologies) according to the manufacturer's protocol with a mean coverage >1,800X.
Importantly, although Kras is a single oncogene, several studies show that Kras codon 12 GAT mutation is amplified during carcinogenesis, even when the mutational specificity of the mutagen is other than the G to A mutation being measured.
The spx gene carrying the G52R mutation was amplified from chromosomal DNA isolated from ORB4055 using oligonucleotides oMMN01-173 and oMMN01-174.
The region of BRCA1 exon 11 containing the 943ins10 mutation was amplified from genomic DNA in the tumor cell line (HCC3153) using standard PCR conditions.
A 400 bp DNA fragment surrounding the ScrF1 restriction site (200 bp on each side) located 25 bp downstream of the point mutation was amplified using the upstream primer ACCTGATACTTATTGCTGGCT and the reverse primer GCTAAGAAGGCGATACAATTC.
CEACAM1 with the appropriate mutation was amplified using the common forward and common reverse primers.
The stop gain mutation was amplified using the primers 5′-GTGGGCTCTGACCTCACC-3′ and 5′-ACCCAGTCTGAGTTTCTGAGA-3′, whereas the missense mutation was amplified using 5′-AGAAGCCCTAATTTACCCCGT-3′ and 5′-CTAACAG CGGCCTCTCTCC-3′.
The cDNA region encompassing the genomic DNA mutation was amplified to detect a possible altered mRNA transcript in the patient.
To detect loss of allele heterozygosity (LOH), the genomic region containing the point mutation was amplified by PCR and sequenced.
