Sentence examples for mutation was performed from inspiring English sources

Each mutation was performed five times with both templates and the results were expressed as mean plus standard deviations.

Because the mutation was performed without change of amino acid sequence, xynA2 encodes the same XynA as that encoded by the wild-type gene.

RT-PCR confirmation of the mutation was performed on RNA extracted from kidney and spleen of both a homozygous mutant mouse and a wildtype littermate.

Mapping of the mutation was performed using a standard outcross strategy to BALB/c mice in combination with SNP markers specific for the C57BL/6J and BALB/c strains.

Genotyping for the Inpp4awbl mutation was performed using a multiplex PCR reaction with allele specific primers: wtF 5'CTACGGATCCTGGCGCAGA, wtR 5'CTGTCGTAGGCACGTGCTCA, mutF 5'AGTGTCAGGCACTGCTTGGA, mutR 5'GAGGGACGCTCTCTGACATT, resulting in the following bands: wild type, 135 bp; mutant, 277 bp.

Correlation analysis of each individual taxon abundance against patient age or CFTR mutation was performed using the multtest package [33] available as part of the Bioconductor suite of analysis programs [34].

Meanwhile, the subtree mutation is performed by selecting a node of a chosen individual and replacing the subtree rooted by that node with a newly randomly generated subtree.

After the crossover operation, mutation is performed to maintain the diversity of solution space and to avoid getting stuck at a local optimum.

Single point crossover and random mutation are performed on the population obtained by tournament selection, then the child population Q t can be generated.

mutation were performed by sequencing.

Each population is initialised independently, and selection, recombination and mutation are performed only within populations.