Sentence examples for mutation was analysed from inspiring English sources

DNA sequencing of genomic and cDNA PCR products was performed in both directions and the position of the putative mutation was analysed individually for each PCR product.

The ADAMTS10 missense mutation was analysed in silico, with conflicting results as to its effects on protein function, but it was predicted to affect the leader sequence.

The correlation between the variation of HV interval (HV2 HV1) and the size of the mutation was analysed using the linear regression method.

The BRAF mutation was analysed in single HMW-MAA+, CD45−, MART-1/gp100+ cells isolated from blood mixed with 928mel cells, which harbour the heterozygous BRAF V600E mutation (Lin et al, 2009).

The IVS2+1G>A and I157T variants in CHEK2 were detected using restriction fragment length polymorphism PCR analysis, and the 1100delC mutation was analysed using allele-specific oligonucleotide PCR.

In all samples in which a PCR product was obtained using the mutation-specific primers, the region surrounding the mutation was analysed by Sanger sequencing to verify the presence of a mutation.

All protein coding genes associated with a regulatory mutation were analysed.

For plasma samples, only the exon 19 deletions, L858R point mutation and T790M point mutation were analysed.

V600E BRAF mutation were analysed after amplification of exon 15, using primers 5′-TGATCAAACTTATAGATATTGCACGA (upstream) and 5′- TCATACAGAACAATTCCAAATGC (downstream).

For that purpose, 14 microsatellites and one SNP spanning 4.98 Mb around the mutation were analysed in 10 mutation carriers representing each family.

Each allele with either a nonsense or essential splice mutation is analysed for morphological differences during the first 5 days of development.