Sentence examples for mutation prediction problem from inspiring English sources

We formalize the somatic mutation prediction problem as a classification problem.

The first publicly available program for the RNA mutation prediction problem that takes into account only single-point mutation predictions was called RNAMute [ 40, 41].

Historically, initial works for the mutation prediction problem can be traced back to [ 37, 38] and have been substantially revived in [ 32, 39].

While the folding prediction problem described above is the most fundamental problem in RNA bioinformatics, the RNA mutation prediction problem is a sub-problem that uses the former multiple times, for various mutation combinations.

There are also some computationally challenging issues in the mutation prediction problem [ 43], mainly in the generalization to multiple-point mutations that can become computationally heavy if a 'brute-force' strategy of calculating all possible mutations is used without devising any unique approach.

The sequences used for illustration in Figures 1, 2, 3, 4, 5, 6 are: Example 1: SSA version I, R = ' GAGCAUCCGUGUAACCAUUCACACUGCUC ' Example 2: SSA version I, R = ' GGGGGGGGGGGGAAAUCCCCCCCCCCCC ' As a possible application of biological significance, the time-dependent approach discussed above is suggested for beneficial use in the problem of deleterious mutation prediction.

Second, a time-dependent approach to contribute in deleterious mutation prediction is suggested, which is still an open problem of considerable biological interest in a variety of RNA systems.

Fortunately, most of us just have a baseball prediction problem.

(b) How is the prediction problem formulated?

AI success hinges on defining your prediction problem correctly.

The posture prediction problem is formulated as an optimization problem.