Sentence examples for mutation occurs commonly from inspiring English sources

The BRAF mutation occurs commonly in papillary thyroid carcinoma (PTC).

Some drug resistance mutations occur commonly in the absence of drug selective pressure, these polymorphic drug-resistance mutations should not be used for surveillance of transmitted drug resistance because they could lead to falsely elevated estimates of transmitted resistance.

Some ARVs resistance-associated mutations occur commonly without selective pressure at highly polymorphic positions; these polymorphic mutations should therefore not be considered in surveillance of transmitted resistance to ARVs [ 16], as their inclusion leads to inflated estimates.

Although we generated multiple independent deletions or observed cosegregation between the deletion and the phenotype of interest, the sequence analysis raised the possibility that second-site mutations occur commonly enough to generate small but consistent phenotype differences between the reciprocal hemizygotes.

Both of these metabolic changes result from oncogene mutations with the tumour cells, most notably the p53 gene-mutation, which occurs commonly in lung cancer.

Dysregulated PI3K/Akt signaling occurs commonly in breast cancers and is due to HER2 amplification, PI3K mutation or PTEN inactivation.

Current SDRM 2009 guidelines propose that such polymorphic drug resistance mutations which occur commonly in the absence of drug selective pressure, and are present in <0.5% of the treated population, could lead to falsely elevated estimates of TDRM, and hence, must not be included for surveillance of transmitted HIVDR [ 22].

This pattern was completely unexpected because mutations encoding resistance occur commonly in laboratory conditions, leading to the expectation that resistance would originate locally on numerous occasions.

Mutations in H3.3 occur commonly in paediatric brain tumours (Maze et al. 2014) and are known to lead genome-wide methylation changes.

The following primers were used to amplify exon 14-15 where the ITD mutation occurs and exon 20 where missense point mutations commonly occur: ITD-F TATCTGCAGAACTGCCTATTCC, and ITD-R CTTTCAGCATTTTGACGGCAACC; MUT-F CTCCTACTGAAGTTGAGTGTAG, and MUT-R CAGTGAGTGCAGTTGTTTACCA, respectively.

This mutation occurs in 60% of melanomas.