Sentence examples for mutation is underlined from inspiring English sources
The sequence of the mutant was found to be: CACTTTAGTTACAACATATTTATT The site of the mutation is underlined.
The nonsense mutation is underlined.
Sequence deleted by gk367 mutation is underlined in red.
10 A PPAD oligonucleotide with a point mutation at the Cys codon at position 351 in PPAD replacing Cys with Ala was designed using the 5′ and 3′ ultrapure primer pair (HYPUR-grade from MWG Eurofins)—atgccctgcat gcccgtactcacgag and ctgttcctaaccaaggtgttcctgaag, respectively with 5′-phosphorylation (mismatch in forward primer creating point mutation is underlined).
EMSAs were performed based on a previously established protocol [46] using an oligonucleotide encompassing the Stat-binding site of the mouse Cdkn1b promoter in wild type form (5'-TTAATTTCCTGTAACATG-3') or in its mutant form (5'- TTAATTGTCTGCGACATG-3'; mutations are underlined) as reported [18].
Codon-changing mutations are underlined.
Transversions are further specified; ins and del denote insertions and deletions of nucleotides, respectively; back mutations are underlined; symbol < denotes parallel mutations; heteroplasmies are labeled using the IUPAC code.
The latter domains are encoded by A exons with homologous defective splice donor sites directly followed by two in-frame stop codons (AT T AGTGA GG to A and G to T mutations are underlined; stop codons in bold letters) (Additional File 2, part B).
In these latter cases, the 5' oligonucleotide primer was as follows: 5'-TCCCCCGGGATCC[4079]AGATAAGTCAGAATCAGAGTT-3' (the added XmaCI restriction site is underlined and mutations in the AP1#1 site are highlighted in boldface).
The base mutation responsible for the amino acid is underlined.
Its biological relevance is underlined by the fact that mutation of the BMP receptor alk6b impairs germ cell differentiation and causes GCT in zebrafish (214).
