Sentence examples for mutation forward from inspiring English sources

DNA was amplified using Taqman Gold (Applied Biosystems) with primer set to RyR1 mutation (forward primer: GTGGAGTGTGGTGCTGTATATC forward and CCGTCACTGTCACCTTCTTG reverse primers).

Two back-to-back primers were designed for generating each mutant gene (H228F, E229D, H233Y and C416G; Table 1), one of which carried the desired mutation (forward primer, fwd) whereas the other did not (reverse primer, rev).

To construct the minigene, gDNA from a patient harboring the c.807C > T mutation was PCR amplified with primers covering part of the exon 5, intron exon region and part of exon 6 including the mutation (forward 5′AAGCTGGTGGTCGAGGAGTA3′, reverse 5′CAAAGTGCTGGAGCTGGAC3′).

In brief, a pair of complementary oligonucleotide primers containing the mutation (forward primer sequence 5′CTGCTGCGGCCGGTGCGCGTG3′ and reverse primer sequence 5′CACGCGCACCGGCCGCAGCAG3′, synthesized by Sigma-Genosys, Haverhill, UK) was used in a PCR reaction (95 °C for 1 min, 60 °C for 1 min, 68 °C for 16 min for 18 cycles) by using hERG in a modified pcDNA3.0 vector as a DNA template.

(primers for c.202 G->A mutation: forward 5'- agaagaagatctaccccaccatct-3' and reverse 5'- ctggtacagagggcagaaccag-3'; primers for c.376A->G: forward 5'-catctgtctgtgtgtctgtctgtc-3' and reverse 5'- ctcatagagtggtgggaggac-3'). Sanger sequencing was done by the Nucleic Acids core facility at CHOP.

siRNA-resistant p62 variants in pmCherry-C1 with silent mutations (forward nucleotide sequence: ORF 970GAgCAaATGGAaTCcGAc987), full-length LC3B, full-length GABARAP, and/or mono-ubiquitin in pEGFP-C1 were used for transfection.

DNA was amplified with normal primer (NP) or mutation specific forward primers (ASO) and a common reverse primer.

The KRAS mutation came forward as a negative predictive factor for OS in patients with rectal cancer and for DFS in stage II colon cancer patients.

The primers used for the introduction of the mutation were; forward (mutation): 5′-T GAC GAT GAT AAT GAC GGA G-3′, reverse (mutation): 5′-C CCT GTC TTA ATC ATC GTC A -3′, forward: 5′-GAT GCC TGC GAC AAC TGC C-5′, and reverse: 5′- CCT TGT CAG CAT CGA AC-3′.

Primers flanking the mutation site (forward, 5′-GTGTGCTATTGG-GTGCCTCT-3′; reverse, 5′-ATTAGGTGACCTGTCGCTG-3′) amplified an amplicon of 326 bp, using 60°C for the annealing step, using JumpStart Taq ReadyMix (Sigma, St Louis, MO).

Transductants were selected on the basis of kanamycin resistance and were analyzed by PCR with primers external to the mutation introduced: forward: 5′-cgttacctttttgcgggtta-3′ and reverse: 5′-aaatctggcgtgttcaggtc-3′.