Sentence examples for mutation creates a from inspiring English sources

This mutation creates a new chromosome, sometimes extremely different from its parents, but anyway useful for the renewal of the population.

That apparently happened, Kinzler says, because the mutation creates a stretch of eight consecutive As, which can throw off the enzyme that transcribes the DNA and completely garble the resulting protein.

The defect or disease arises when a mutation creates a mismatch between an organism and its environment.

The branch point A mutation creates a BstBI site; the branch point B mutation creates a Sau961 site; the branch point C mutation creates an NheI site; the two polyY tract mutations and the splice acceptor mutation delete a PstI site.

We first tested deletion of the proline-rich wrist region insertion in the human α-subunit (αHPWR−/βA mutant), which revealed that this mutation creates a remarkably potent antagonist that no longer requires betaglycan (IC50 = 0.27 nM with betaglycan vs. IC50 = 0.31 nM without betaglycan) (Table 1).

This mutation creates a stop codon at amino acid 570.

The c.1222C>T mutation creates an additional NlaIII site, and amplicons harbouring this mutation are digested into three fragments of 25, 45 and 148 bp.

The mutation is in the following sequence: GCAAGTTTACCAATCTTCCC G CTGGGTTCCAGTTATCAAGG. As this mutation creates an additional site for restriction endonuclease digestion using TspRI, the mutation was rechecked by TspRI digestion of the PCR product.

If a mutation created a salmonella strain that always opted out of the suicide attacks, these salmonella would benefit in the short term within the gut, but they would have trouble spreading to the next victim.

The researchers believe the pepper's capsaicin-creating gene appeared after five mutations occurred during DNA replication, with the final mutation creating a functional copy.

These mice were bred to the Rb1ΔL mutation, creating a mixed 129/B6/FVB genetic background.