Sentence examples for mutation analysis were from inspiring English sources

Immunohistochemistry staining of p53 and TP53 gene mutation analysis were performed in 148 gastric cancer patients.

Blood samples for mutation analysis were taken after counselling according to the guidelines of the Consensus Committees of the European Registry of Hereditary Pancreatic Diseases [ 17].

Data on family history of cancer or blood samples for mutation analysis were not available since the study was retrospective and register-based.

The sequence identity between the draft genomes ATCC948-1 ATCC948-2 is 98.408.40% after alignment with progressiveMauve (Darling et al. 2010), so most of the analyzed sites for mutation analysis were shared.

Primers for mutation analysis were as follows: exon 18 – GCTGAGGTGACCCTTGTCTC (sense), ACAGCTTGCAAGGACTCTGG (antisense); exon 19 – CATGTGGCACCATCTCACA (sense), CAGCTGCCAGACATGAGAAA (antisense); exon 20 – CACACTGACGTGGCCTCTCC (sense), TATCTCCCCTCCCCGTATCT (antisense); exon 21 – CCTCACAGCAGGGTCTTCTC (sense), CCTGGTGTCAGGAAAATGCT (antisense).

MSI analysis, additional MMR immunohistochemistry (IHC) and MMR germline mutation analysis were performed due to a relatively young age of onset and/or a suspected family history of Lynch syndrome.

Mutation analysis was performed simultaneously.

Currently, EPCAM gene mutation analysis is not available in Japan.

Hence, mutation analysis is necessary prior to treatment.

Mutation analysis was performed to evaluate the capabilities of the test cases to detect faults.

Nevertheless, NOTCH3 gene mutation analysis is still costly and time-consuming [4, 14].