As a control, a mutated version of this promoter was synthesized (Medigenomics) to contain four point mutations in each SRE element as previously reported [49] (AAAAGAACCCCTATGCAAACTCCTCCCCCTGC, mutations underlined).
A mutated version of the virus was more effective at entering human cells, scientists report.
In Huntington's disease, a mutated version of the huntingtin protein leads to cell death.
The mutated version of the huntingtin protein has been shown to disrupt transcription.
Genetic testing shows whether or not an individual carries the HD allele, a mutated version of the Huntington gene.
This gene encodes a mutated version of one of the proteins that the virus needs to copy itself.
The disease is caused by a mutated version of the gene that helps make hemoglobin a protein that carries oxygen in red blood cells.
Thus, a child who has one affected parent has a 50% risk of inheriting the mutated version of the Huntington gene and eventually developing HD.
However bacteria containing only one half of the toxin-intein fusion (N or C) or the mutated version of N plasmid (n*) survive.
In his December postscript, Mr. Bobbitt also argues that it is a mistake to think of Al Qaeda as a "stateless gang"; instead, it must be seen as a "virtual state," a "malignant and mutated version of the market-state".
As is the case for Parkinson's disease, deficits in both manual and speech motor control, and in comprehending grammar and abstract reasoning, occur in family members who have a mutated version of the gene.
