Because specific, high affinity syt 7 antibodies are not currently available, a c-myc tag, TGGAGCAGAAGCTGATCAGCGAGGAGGACCTGAACGGAATT, was added to the N-terminus of WT and syt 7 4D/N mutant to detect and localize the exogenously expressed proteins.
Last but not least, when using a 2-odor differential conditioning paradigm for neurogenetic analyses, one has to control for the mutants' ability to detect both odors.
The inability of mutant NOD2 to detect microbial constituents translates into a lack of activation of NF-κB and subsequent decreased IL-1β release [ 122].
The comparison between the WT and the single gpc-A1 mutant, expected to detect mainly GPC-A1-regulated genes, showed a much lower number of DE genes (520 loci) than the previous comparison.
These mutants did fail to detect cadaverine, suggesting that the receptors are disrupted in some way.
Focusing general mutagenesis on a few cells (instead of a small genomic region) can also explain why unselected mutants were hard to detect in the starved population as a whole.
The improvement was made because when analyzing the first six known mutants, several mutants were relatively easier to detect, whereas one or two others were more difficult to detect.
By quantitative comparison of IdU-CldU labeled progenitors in the cortical VZ of wild-type and Nde1−/− mutant, we failed to detect a significant difference in the early S phase population but found more mutant progenitors in mid to late S phase.
In contrast to industrial processing where maximum release of sugars is desirable, we wish to identify mild pretreatment conditions that allow the enzymes to release limited quantities of sugar from wild type stems and will enable changes in the ease of sugar mobilisation with enzymes in potential mutants to be detected.
