Sentence examples for mutants could differentiate from inspiring English sources

Both s* and s mutants could differentiate Anneaux.

A Taqman primer/probe pair targeted the MUT c.322C>T mutation on chromosome 6 and could differentiate between genotypes: ACGTGGACCATATCCTACCATGTAT (primer 1), TTGCTTTCTTCCACAGTACTAAAACCA (primer 2), FAM-ATACTGGCAGATGGTC (mutant probe), VIC-ACTGGCGGATGGTC (wildtype probe).

Although the complementary ssDNA made the fluorescence recover, the hydrogen bonds and chemical coupling also played a significant role between the unpaired bases and aldehyde group, which could differentiate the subtle differences in such mutant DNA.

It appeared that the MHC-encoded components critical for this recognition were the class I molecules because mice could differentiate between urine volatiles of wild type and either MHC class I mutants [5] or knockout strains deficient in the ß2m gene and therefore lacking the expression of the MHC class I heterodimers on the cell surface [6, reviewed in Refs. 7, 8].

For example, they could differentiate black tape against dark wood.

Suddenly the company could differentiate itself from competitors.

"Xerox's competitors could differentiate themselves from each other, but we had to differentiate Xerox from itself".

The overall SIPA could differentiate between AVGs social features.

Maddon continued: "I think you could differentiate strikeouts.

Basically, people's ability to differentiate between fact and fiction disrupted our experiment into whether they could differentiate between fact and fiction".

Some of these infiltrating cells could differentiate into DCs and may be involved in immune induction.