Sentence examples for mutant which contains from inspiring English sources

On fibronectin-coated substrata, this response can be abrogated by culturing cells on rigid substrata coated with a fibronectin mutant which contains a stabilized RGD and PHSRN synergy site that supports α3 and α5 integrin engagement [156].

GFP-TM-NLS mutant, which contains the signal peptide (aa 1 25), the trans membrane and the NLS domains (aa 646 681) was amplified using 2 sets of primers: 5'GAAGATCTGCCACCACCATGCGACCCTCCG, 5'CAGTGGCGATCAGAGCCCGACTCG and 5' GGGCTCTGATCGCCACTGGGATG, 5'GGAATTCCCTCCGCAGCGTGC.

The data showed that the HVGGSSV peptide binds to the TIP-1 protein through the PDZ domain, it can not bind to the H90A mutant which contains a dysfunctional PDZ domain.

Vpu RD (URD) is a mutant which contains a randomized amino acid sequence in the membrane spanning region and is therefore impaired in the enhancement of viral particle release, but not in its ability to degrade CD4 [27].

GFP-TM mutant, which contains the signal peptide (aa 1 25), and the trans membrane domain (aa 646 668) was amplified using 2 sets of primers: 5'GAAGATCTGCCACCACCATGCGACCCTCCG, 5' CAGTGGCGATCAGAGCCCGACTCG and 5' GGGCTCTGATCGCCACTGGGATG, 5' GGAATTCCATGAAGAGGCCG.

In addition we constructed a double mutant of HLA-G at residues 76 and 79 and a triple mutant which contains the double mutation and another mutation in threonine 80 either to aspargine or to lysine (which mimics the KIR2D binding site to HLA-C1 or C2 allotypes respectively).

The specific activity of carboxysomes purified from the cbbS::Tc NC cbbS mutant, which contained chimeric RubisCO, was only 10% of that exhibited by wild type carboxysomes.

Similarly, the 3′-UTR mutant, which contained mutated miR-509-5p-binding miR-509-5p-binding miR-509-5p-binding miR-509-5p-bindingsites

Consistent with this suggested function of AOX, developing fibers of the im mutant which contained high levels of AOX had reduced levels of ROS.

The far-UV CD spectra of the Y142G mutant and the wild-type enzyme were similar (results not shown); nevertheless, this mutant, which contained the smallest residue (glycine), showed no activity.

Conversely, in nodules infected by the S. meliloti bacA mutant which contain symbiotic cells with undifferentiated bacteroids, only a subset of NCR genes is activated while in other mutants, forming normal symbiotic cells with differentiated bacteroids, NCR genes are activated to a similar extend as in the wild type [ 18, 19].