Sentence examples for mutant vectors are from inspiring English sources

Exact(1)

Mutant vectors are based on Eq. (33).

Similar(59)

In our current study, with the effective transfection system shown in Fig. 1, PRL-3 wild type and the mutant vectors were introduced into B16F1 to determine the subcellular localization of PRL-3.

Mena structural mutant vectors were a gift from F. Gertler (Loureiro et al., 2002).

The corresponding mutant vectors were obtained by using QuickChange Lightning Multi Site Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA; Cat#210515-5).

The wild type or mutant vectors were co-transfected with miR-205 mimics or negative control miRNA in Ishikawa cells.

Sp1-1 mutant, Sp1-2 mutant, Sp1-3 mutand, and Sp1-4 mutant vectors were generated with deletion mutation by using QuickChange Lightning Multi Site Directed Mutagenesis Kit (Agilent Technologies, Cat#210515-5).

In addition, novel mutant vectors were developed subsequently and such mutants have reduced the problems associated with viral cytotoxicity and immune rejection [ 2, 15, 16].

PGL3cm-CCND1-3′UTR wild-type and pGL3cm-CCND1-3′UTR mutant vectors were received as generous gifts from Dr Shi-Mei Zhuang (School of Life Sciences, Sun-Yat-sen Sun-Yat-sen Sun-Yat-sennstructed andpreviously described (Xu et al, 2009).

Mutant vector was generated in Invitrogen by replacing the predicted target region with its reverse sequence (from AAGCACCAATAGCCTTGTTGGTC to CTGGTTGTTCCGATAACCACGAA).

To further study the mechanism by which hypoxia signaling initiated c-Myc degredation, wild-type c-Myc vector or c-Myc T58A mutant vector was transfected into A549 cells.

The ChoRE deletion mutant vector was prepared by Inverse PCR.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: